chapter 9 fips requirements for a type 1 spb
báo cáo khoa học: "A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling" ppsx
Ngày tải lên :
11/08/2014, 00:22
... experimentally, the 15 nm nanoparticle assay have a 89 ± Hz signal at 5.2 × 10 -10 M target concentration and 12 ± Hz signal at 5.2 × 10 -11 M target concentration using 5.25 × 10 10 gold nanoparticles (Figure ... using quartz crystal microbalance Nanotechnology 2007, doi :10 .11 86 /14 77- 315 5-8-3 Cite this article as: Uludağ et al.: A signal amplification assay for HSV type viral DNA detection using nanoparticles ... dynamic range and the data variation associated with the signal measurements; where a Z-factor between 0.5 and 1. 0 is an excellent assay; between and 0.5 is marginal, and less than means that...
- 12
- 394
- 0
Tài liệu Practical mod_perl-CHAPTER 9:Essential Tools for Performance Tuning pptx
Ngày tải lên :
26/01/2014, 07:20
... relevant arguments ApacheBench ApacheBench (ab) is a tool for benchmarking your Apache HTTP server It is designed to give you an idea of the performance that your current Apache installation can ... output for postprocessing, and reports median and standard deviation values HTTPD::Bench::ApacheBench, available from CPAN, provides a Perl interface for ab httperf httperf is another tool for measuring ... concat: wallclock ref_array: wallclock iterations of array, concat, ref_array secs ( 1. 59 usr + 0. 01 sys = 1. 60 CPU) secs ( 1. 16 usr + 0.04 sys = 1. 20 CPU) secs ( 1. 66 usr + 0.05 sys = 1. 71 CPU)...
- 26
- 372
- 0
Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx
Ngày tải lên :
16/03/2014, 14:20
... (19 94) The CCP4 suite: programs for protein crystallography Acta Crystallogr D Biol Crystallogr 50, 760–763 2692 22 Navaza J (19 94) AmoRe: an automated package for molecular replacement Acta ... (28S rRNA-N-glycosidases) of the plant Saponaria officinalis L (Caryophyllaceae) Biochim Biophys Acta 12 16, 31 42 10 Arias FJ, Antolin P, de Torre C, Barriuso B, Iglesias R, Rojo MA, Ferreras JM, ... Moreira RA, Beltramini LM & Araujo APU (2005) Pulchellin, a highly toxic type ribosome-inactivating protein from Abrus pulchellus FEBS J 272, 12 01 12 10 12 Altschul SF, Madden TL, Schaffer AA, Zhang...
- 9
- 424
- 0
A Practical Guide to Particle Counting for Drinking Water Treatment - Chapter 9 ppt
Ngày tải lên :
18/06/2014, 19:20
... operator with an alarm message Some particle counters provide local display of data and alarms These are primarily of use during installation and maintenance The particle counters are usually mounted ... systems have separate analog input racks, which may require long cable runs Several parameters should be investigated when evaluating analog inputs on a particle counter system: © 20 01 by CRC ... This provides a way for the data to be properly labeled without attention from the operator Backwashing will usually increase the particle counts dramatically, and the data generated during this...
- 5
- 297
- 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
Ngày tải lên :
19/06/2014, 22:20
... [ 21, 23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against ... MDA5/MAVSdependent and MDA5/MAVS/RNA polymerase III-independent pathways J Virol 2 010 , 84 :11 350 -11 358 Page 12 of 12 doi :10 .11 86 /17 42-2094-8-99 Cite this article as: Furr et al.: A role for DNA-dependent activator ... encephalitis and accounts for 95% of all fatal cases of sporadic viral encephalitis [1] Untreated HSV -1 encephalitis has a 70% mortality rate and patients who receive early treatment have only a...
- 12
- 529
- 0
A Prince of Sinners E. Phillips Oppenheim BOOK 1 CHAPTER 9 doc
Ngày tải lên :
06/07/2014, 02:20
... because the manufacturer has few or no orders I want the immediate cause for that, and I go to the manufacturer I ask him why he has no orders He tells me, because every steamer from America is ... given half -a- crown to a hungry child." "Still it is a magnificent gift," he declared "We can open all our relief stations again I believe that you are a little prejudiced against Lord Arranmore." ... beautifully on paper, and bring a great country into the throes of commercial ruin We won't have men who think that the laws their fathers made are good enough for them, and that all change is dangerous,...
- 9
- 292
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
Ngày tải lên :
09/08/2014, 08:22
... Primers and probes 11 β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC ... CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer: TGGACAAGAACAGCAACGAG Reverse primer: TTGTCACTGGTCAGCTCCAG...
- 10
- 438
- 0
Product Design for the Environment: A Life Cycle Approach - Chapter 9 doc
Ngày tải lên :
11/08/2014, 21:21
... constructional system that are ascribable to these properties (Navin-Chandra, 19 91; Simon and Dowie, 19 93; Takata et al., 2003) The more important indices are based on certain primary considerations For ... Theory, information acquisition and application, International Journal of Project Management, 15 (6), 335–344, 19 97 Yamagiwa, Y., Negishi, T., and Takeda, K., Life cycle design achieving a balance ... 19 84 Makino, A. , Barkan, P., and Pfaff, R., Design for serviceability, in Proceedings of ASME Winter Annual Meeting, San Francisco, 19 89, 11 7 12 0 Navin-Chandra, D., Design for environmentability,...
- 34
- 341
- 0
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
Ngày tải lên :
12/08/2014, 23:22
... * ** Tax1 (18 5 -19 1) * Tax1 Transformation (Number) 10 0 Tax1 (18 5-207) B) Tax 40 20 Tax1 Tax1 (18 5-207) Tax1 (18 5 -19 1) Tax1 (19 8-207) Tax207 Figure The Tax1 (18 5-207) region negatively regulates the ... Transformation (Number) 10 0 60 Tax207 L20 0A Tax1 L20 0A L1 91- 19 5A B) Tax1 L1 91- 19 5A Cryptic NES 18 5 211 ዪዲዬድዧዮዥዡዡየየድዧዥዯየደደዣዝየዥዥየዬዡዠ ω ޓωω ω ዝ ޓዝዝޓޓޓޓዝ Tax 40 20 Tax1 Tax1 L1 91- 19 5A Tax1 ... C) 10 0 * * 80 80 Transformation (Number) 60 40 20 40 20 Tax 224 Tax 232 Tax Tax 300 Tax2B Tax2B Tax 207 Tax300 D) Tax 15 4 Tax232 Tax1 Tax224 Tax 207 Tax207 Tax 18 4 Tax184 Tax154 Tax1 Tax1 Tax 15 4...
- 11
- 548
- 0
Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx
Ngày tải lên :
13/08/2014, 01:20
... 11 19 -11 38 (5’ CCCAAAGTCTCT CACATTA-3’), 12 72 -12 80 (5’-GGACAAACTTAAC AACAAT-3’), 15 91- 1609 (GCAAGGGAAGGAATATGTA-3’), and 2070-2088 (5’-GCTAATGGCTGG ATTTATT-3’) TZM-bl and U373 cells were transfected ... 2006, 2 81: 213 69- 213 76 52 Hattori M, Osterfield M, Flanagan JG: Regulated cleavage of a contactmediated axon repellent Science 2000, 289 :13 60 -13 65 53 Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono ... Hartmann D, Saftig P: ADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocation Proc Natl Acad Sci USA 2005, 10 2: 918 2- 918 7 Nagano...
- 14
- 308
- 0
Báo cáo y học: "Requirements for the selective degradation of CD4 receptor molecules by the human immunodeficiency virus type 1 Vpu protein in the endoplasmic reticulum" doc
Ngày tải lên :
13/08/2014, 05:22
... Immunoprecipitates were resolved on a 12 .5% SDS-polyacrylamide tricine gel and analyzed by autoradiography Scanning of the autoradiograms was performed on an AGFA Duoscan T1200 scanner Densitometric analysis ... conjugates signal associated with membrane and supernatant fractions revealed that approximately 50% of the membrane-associated signal could be salt washed at basic pH (Fig 5C, compare lane to lane ... macrophages, by a mechanism that appears to involve the inactivation of a putative host cell factor that restricts viral particle release in a cell -type dependent manner [10 ,16 19] From a mechanistic...
- 15
- 389
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
Ngày tải lên :
13/08/2014, 09:21
... Tax1 in the altered expression of cyclin D2, p18Ink4 and p21Waf1/Cip1/Sdi1 Oncogene 19 96, 12 :16 45 -16 52 Mori N, Fujii M, Hinz M, Nakayama K, Yamada Y, Ikeda S, Yamasaki Y, Kashanchi F, Tanaka ... donating the Tax2B plasmid and the antibody against Tax2B We thank the Takeda pharmaceutical company for providing recombinant human IL-2 We also thank Sayoko Takizawa and Chika Yamamoto for the excellent ... several mutant genes that had been previously characterized (Figure and Table 1) [33] The Tax∆C gene contains a C-terminal four-amino acid deletion abrogating PBM in Tax1 Tax35 1A and Tax35 3A are...
- 7
- 177
- 0
Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx
Ngày tải lên :
14/08/2014, 19:22
... Vaccines and Therapy 2004, 2:7 10 11 12 13 14 15 16 17 18 19 20 21 22 Shand N, Weber F, Mariani L, Bernstein M, Gianella-Borradori A, Long Z, Sorensen AG, Barbier N: A phase – clinical trial of ... experiments and enzymatic assays SJ and AS carried out the immunohistochemical studies NGR and AS designed the experiments and evaluated the data All authors have read and approved the manuscript Acknowledgements ... Therapy of malignant brain tumors by intratumoral implantation of retroviral vector-producing cells Nat Med 19 97, 3 :13 54 -13 61 Page 11 of 13 (page number not for citation purposes) Genetic Vaccines...
- 13
- 388
- 0
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
Ngày tải lên :
13/04/2013, 10:30
... 35.8 19 .9 D D 10 store size 3.05 1. 14 13 .6 11 location 2.96 1. 14 10 .2 12 distance 2.92 1. 23 10 .2 13 check out 2.73 1. 29 13 .1 14 air conditioning 2.50 1. 21 9 .1 Note: 1= not important at all; 5= ... begins, p .14 -15 ; 10 Asian Retailer, 19 93 Jun., Taiwan retailing is full ahead, p .13 -14 ; 11 Asian Retailer, 19 94 Jan., Transition time in Hongkong, p.24-26; 12 Asian Retailer, 19 94 Feb., Healthy economy ... in Asia, p .19 -20; Asian Retailer, 19 92 Oct., Market thrives on hidden purchasing power, p .10 ; Asian Retailer, 19 92 Nov., Malaysian supermarkets: tough times now and ahead, p .12 -13 ; Asian Retailer,...
- 51
- 1K
- 3
Kiểm tra 1 tiết Đại số 9 chương III-de A .doc
Ngày tải lên :
16/07/2013, 01:25
... qua hai điểm A( 2; 1) B (1; 2) có phương trình là: A y = − x + B y = − x − C y = x + D m = − D y = x − 4 x + y = x − 3y = Câu Cặp số sau nghiệm hệ phương trình: A (−2 ;1) B (2; 1) C (2; 1) ... trị a, b hệ phương trình A a = 2; b = B a = 0; b = C a = −2; b = −2 D a = 4; b = Câu Cho phương trình x + y = (1) Phương trình kết hợp với (1) để hệ phương trình bậc hai ẩn có vô số nghiệm? A ... 1) D (−2; 1) ax + by = c (a, b, c, a , b’, c’ khác 0) a x + b′y = c′ Câu Cho hệ phương trình : (I) Hãy điền (Đ) sai (S) vào ô trống: a b′ c′ = ≠ a b c a b ≠ Hệ (I) có nghiệm a b′ Hệ (I)...
- 11
- 1.5K
- 7
G.a lớp 1 tuần 9 ( BL )
Ngày tải lên :
27/09/2013, 12:10
... chnh sa v giỳp hs yu c on th ng dng: - HS quan sỏt tranh rỳt on th ng dng: Giú t tay m Ru ng say Thay cho giú tri Gia tra oi - HS khỏ c trn - HS c cỏ nhõn( 10 em) - Yờu cu hs tỡm ting cha va ụn ... ng 1: Quan sỏt tranh( bi 1) - GV treo tranh yờu cu hs quan sỏt v tho lun ni dung tng tranh + HS tho lun theo cp - Gi 1s hs nờu ni dung mi tranh C lp nhn xột, b xung - GV cht li ni dung tng tranh ... + = 213 Năm học 2 010 -2 011 Trờng tiểu học Bảo Lý Giáo án Buổi 1 + = > < Bài 4: = + + = a) ; 10 ; ; ; ; b) + ; + ; + ; + ; + Bài 5: Viết phép tính thích hợp Th sỏu ngy thỏng 11 nm 2 019 Tp...
- 19
- 306
- 0
G A lop 1 tuan 9 chuan
Ngày tải lên :
09/10/2013, 13:11
... lại nd tranh kl: T1: Anh đ a cam cho em ăn, em nói lời cảm ơn Anh quan tâm đến em, em lễ phép với anh T2: Hai chị em chơi đồ hàng, chị giúp em mặc áo cho búp bê Hai chị em chơi với h a thuận, ... bị sau Ngày day : Thứ ngày Tiếng Việt tháng 11 năm 2009 Tập viết tuần 7: x a ,m a d a, ngà voi , gà mái… I Mục tiêu: -Viết chữ : x a , m a d a ,ngà voi , gà mái… kiểu chữ viết thường, cỡ v a theo ... vần ay (a đứng trước âm y đứng sau); HS đánh vần a - y- ay (cá nhân, nhóm; lớp); HS đọc: ay (cá nhân; nhóm) + Có vần ay muốn có tiếng bay ta làm nào? (thêm âm b) + HS nêu; GV ghi bảng: bay ;...
- 18
- 396
- 0
Tài liệu BT TRẮC NGHIỆM TIẾNG ANH 9 GRAMMAR TEST A (UNIT 1+2) pptx
Ngày tải lên :
24/12/2013, 10:17
... been kept) 15 I’m hungry I anything since am (hasn’t eaten / haven’t eaten / haven’t eated / don’t eat) 16 When did you buy this car? (since ten years / ten years ago / for ten years / in ... years) 17 I this man 10 years ago (have met / met / is met / meet) 18 These designers inspiration from Vietnam’s ethnic minorities since last year (have taken / too / has taken / take) ... take) 19 I a lot of people in the last few days (met / meet / have met / has met) 20 you a lot recently, Jane? (Did … travel / Have … traveled / Has … traveled / Do … travel) 21 We can’t...
- 6
- 1.8K
- 11
